Search This Blog

Wednesday, February 22, 2012

Animals’ secret language found


THE UNIVERSITY OF QUEENSLAND   
R-J-Seymour_-_glasses
The polarization of light is a dimension of reality invisible to most people without specialized instruments. 
Image: R-J-Seymour/iStockphoto
Australian and UK researchers have made new findings about a form of secret language in the animal kingdom using polarization, a type of light that humans cannot see.

In a new paper published in Current Biology, researchers at The University of Queensland's (UQ) Queensland Brain Institute and at the University of Bristol in the UK have examined polarization vision and its significance in biological signalling.

They focused on a type of cuttlefish (close relative to octopus and squid) to demonstrate how polarization could be used as an important kind of communication in the animal kingdom.

The paper shows cephalopods such as cuttlefish have the ability to see in many more directions of polarised light than previously thought.

Co-author Professor Justin Marshall, who has published more 20 scientific papers on polarisation, said humans had not yet developed the language to describe all the roles of polarisation in nature.

Professor Marshall said most people would be familiar with the concept of polarization through the use of polarised sunglasses, but polarisation also had an important application in the detection of skin cancer in humans, as a viewing scope containing polarised light was a technology currently used to detect melanomas.

“Our work is borrowing from millions of years of evolution, so perhaps we can learn a lot from nature in terms of better solutions to the problems mankind faces,” he said.

It has been known for years that many animals have better colour vision than humans and also many have polarisation vision (P-vision). They literally see things that we can't.

The polarisation of light is a dimension of reality invisible to most people without specialized instruments.

“Mammals and some other groups, don't appear to have P-vision, although many parts of the animal kingdom do,” he said.

“For example, other studies have found that animals such as ants and bees and even fish may used polarization to navigate.

“Polarisation in animals has previously just been categorized as just an unusual and interesting phenomenon but the work we've done in the past few years shows that animals use P-vision in the same way we use colour, to communicate with each other.”

Professor Marshall said ironically animals such as cephalopods (cuttlefish, squid and octopi) and many crustaceans were colour blind. Instead they have concentrated on polarisation vision.

“They have evolved perfectly to see light we cannot see and also use polarised skin patterns to camouflage into their backgrounds, giving them an advantage over some predators who did not have P-vision.

“While colour is very useful in terrestrial or shallow-water environments, it is an unreliable cue deeper in water due to the spectral modification of light as it travels through water of various depths or of varying optical quality,” he said.

“Here, polarization vision and communication has special utility and consequently has evolved in numerous marine species, as well as at least one terrestrial animal.”

Professor Marshall, of UQ's Queensland Brain Institute, last year received $962,000, including a Discovery Outstanding Researcher Award (DORA), for a three-year study of colour and polarization vision on the Great Barrier Reef.

As the tightest-packed ecosystem on the planet, coral reefs make for a competitive environment, from which has evolved unique sensory adaptations that Professor Marshall's research will investigate.
Editor's Note: Original news release can be found here.

Omega-3 can help small babies



THE UNIVERSITY OF SYDNEY   



Omega-3 fatty acids may have a role in preventing heart attacks or strokes in adults who were small at birth, according to University of Sydney researchers.

The findings published in Pediatrics, the journal of the American Academy of Pediatrics, suggest the use of supplements for the first five years of a child's life may prevent the development of such life-threatening conditions.

"People who were small at birth have an increased risk of cardiovascular disease," said Dr Michael Skilton, lead author of the paper, from the University's Boden Institute of Obesity, Nutrition, Exercise and Eating Disorders.

The definition of small at birth applies to the lowest 10% of birth weights of all babies born in Australiaeach year and no preventative strategy to address their risk has previously been identified.

"The greater degree of risk is partly due to the development, from early childhood, of arterial wall thickening which is an indicator of early atherosclerosis, leading to a build-up of fat and plaque, and hardening of the blood vessels," Dr Skilton said.

The study followed the same subjects as those taking part in the Childhood Asthma Prevention Study - 616 children born at term.

Participants belonged to one of two groups. The omega-3 group received a 500 milligram daily fish oil supplement from the start of bottle-feeding or six months of age until five years of age. They were also supplied with canola-based margarines and cooking oil for the same period.

The control group received a 500 milligram daily sunflower oil supplement from the start of bottle-feeding or from 6 months of age until 5 years of age. They were supplied with omega-6 fatty acid-rich margarines and cooking oil.

At eight-years of age these children were tested for the presence of arterial wall thickening, an indicator of early atherosclerosis associated with later cardiovascular disease.

The children receiving the sunflower supplement had thicker arterial walls if they were small at birth. This was prevented in the children receiving the omega-3 supplement.

"The results of the paper suggest that babies born small may benefit from a daily omega-3 supplement, however further studies are required to confirm this."
Editor's Note: Original news release can be found here.

How DNA Copies Itself

                          With their discovery of the structure of DNA Watson and Crick started the unravelling of the mystery around this molecule. But after that the questions started rising: how was the DNA able to copy itself with every cell division? And how did the DNA eventually lead to genetic properties? 


The copying
When a cell divides, the two strands of DNA are seperated. The bonds between the basepairs are broken, forming a sort of zipper. 

After seperation the two strands exist with single bases. Then the copying starts. On the opposite of each A in the strand a T is built in the new strand, on the opposite of a G a C is built in. The missing strand is built again from single nucleotides, so a copy is made. This is also done for the other strand. In the picture the pink strand is the old strand and the blue one the new strand. Eventually two double stranded DNA molecules exist. These are seperated from each other during cell division, so each cell gets its own molecule. 

The genetic code
DNA codes for genetic properties in our body by the unique sequence of the bases. To express these properties the nucleotide sequence must be translated into proteins. Proteins consist of a sequence of specific building blocks. these building blocks are called amino acids. 
 There are 20 different amino acids. Each amino acids is coded by a 'word' of 3 bases. Such a word is called a codon. Because there are many different combinations of 3 bases there is a clear overview table of all the codons. All amino acids also have a 1-letter code, not shown in the table. There is 1 codon that codes a starting-signal in a protein, that is the codon for the amino acid Methionine (Met): AUG. And there are 3 codons that give a stop-signal. The nucleotide sequence between the startcodon and the stopcodon is eventually translated into a protein. 



The translation
To go from nucleotide sequence to proteins the DNA must first be translated to a structure that is similar to DNA. This is RNA (RiboNucleicAcid) and it has almost the same structure as DNA. There is an important difference between DNA and RNA: RNA is single stranded, in contrary to DNA, which is double stranded. And besides that RNA has in stead of the base Thymidine (T) the base Uracil (U). The function of RNA is to transport the genetic material and thus is a sort of messenger. That is why the molecule is also called messenger RNA (mRNA). mRNA has to take the genetic information from inside the nucleus to the outside, so the translation into protein can continue. This happens on ribosomes, a compartment of the cell. The ribosomes read the nucleotide sequence between the startcodon and the stopcodon and translate this into an amino acid sequence: 

DNA    ATGCGTGCAATGTTTACGCGTAAAGCGTGCACGTTAGAGTGA
       TACGCACGTTACAAATGCGCATTTCGCACGTGCAATCTCACT

RNA    AUGCGUGCAAUGUUUACGCGUAAAGCGUGCACGUUAGAGUGA

Protein   Start - R-A-M-F-T-R-K-A-C-T-L-E - Stop


This sequence forms a protein with a certain genetic property. For instance a protein that codes for eyecolor or bloodgroup. 

WHY TAKING A BREAK IS BETTER FOR YOUR BIZ



Test of a True Entrepreneur: Can You Step Away?

Can your business run indefinitely without you at the helm? Michael E. Gerber, author of The E-Myth, outlines the steps you need to take to get there.

Business owners, especially those just starting out, often make the mistake of getting caught up in the day-to-day operations of their business—the work of running the business—so much so that they don’t take time to consider how the business runs.
Are you guilty of putting your nose to the grindstone and forgetting to come up for a look around?
If so, it is critical that you understand the point I’m about to make. For if you do, neither your business nor your life will ever be the same.
Your business is not your life.
Your business and your life are two totally separate things.
At its best, your business is something apart from you, rather than a part of you, with its own rules and its own purposes. An organism, you might say, will live or die according to how well it performs its sole function: to find and keep customers.
Once you recognise that the purpose of your life is not to serve your business but that the primary purpose of your business is to serve your life, you can then go to work on your business, rather than in it, with a full understanding of why it is absolutely necessary for you to do so.
This is where you can put the model of the Franchise Prototype to work for you.
Working on your business rather than in your business will become the central theme of your daily activity, the prime catalyst for everything you do from this moment forward.
How do you work on your business?
Pretend that the business you own—or want to own—is the prototype, or will be the prototype, for 5,000 more just like it.
Not almost like it, but just like it. Perfect replicates. Clones.
In other words, pretend that you are going to franchise your business.
And if you are going to set up a model that is the prototype, there are rules you must follow:
Continue reading this article at INC.com after the break!
 

THE UNSPOKEN COSTS ASSOCIATED WITH A SUCCESSFUL START-UP




It’s easy to dream about making it big and enticing to fantasize about fame, money and opportunity. The benefits of success are well advertised. What is not often spoken of are the sacrifices. Find out what costs come along with achieving true business success.
INC shares…
How many young people are inspired to dream of founding businesses by the incredible success of seemingly normal(ish) Mark Zuckerberg? Do these start-up dreams have under-discussed costs?
That’s what three entrepreneurs whose views were rounded up by Jason Kottkestarted to wonder after reading Walter Isaacson’s biography of Jobs. The short post is well worth a read in full, but the gist is encapsulated in the words of Jeff Atwood, a co-founder of Stack Exchange:
Start-up life is hard on families. We just welcomed two new members into our family, and running as fast as you can isn’t sustainable for parents of multiple small children. The death of Steve Jobs, and his subsequent posthumous biography, highlighted the risks for a lot of folks. [...] Stack Overflow and Stack Exchange have been wildly successful, but I finally realized that success at the cost of my children is not success. It is failure.
Designer and entrepreneur Eric Karjaluoto expresses similar sentiments. “I admire [Jobs] for the mountains he climbed. At the same time, I wonder if he missed the whole point, becoming the John Henry of our time. He won the race, but at what cost?” Kottke admits that “since Jobs died, I’ve been pushing a little less hard” toward a definition of success that involves insane working hours.
And it is not just Kottke and company who are wondering whether most of us really want to pay the true costs of anything resembling the Zuckerberg or Jobs-type of success. Blogger Penelope Trunk has a woman’s perspective on the issue and focuses on Facebook’s soon-to-be-massively-wealthy COO Sheryl Sandberg in a new post. While she has nothing against Sandberg, whom she praises as super smart and extremely supportive of women’s ambitions, Trunk still has questions about whether Sandberg’s success is actually an appealing option for the vast majority of women.
Sandberg wants to be a role model for women who want big, exciting careers. But here’s the problem: women don’t want to be Sandberg. It’s no coincidence that the number one woman on the list of self-made millionaires is Oprah. She has no kids and no husband. She’s fascinating, nice, and smart. But few of us would really enjoy her life.
Sandberg and Oprah represent extreme choices in life. The things they give up are not things that most women would want to give up in exchange for the wild career success they could have.
The bottom line for Trunk is the same as it in for Kottke—seeing your kids and having start-up success are not compatible goals. That might not often be clearly articulated in the culture but it’s true, and this makes high-octane entrepreneurialism a hard choice for many. “Sandberg is not a role model. She’s an aberration,” concludes Trunk.
Get the full story at INC!
 

THE FIVE BEST SELLING CARS THROUGHOUT TIME




Some things really are built to last. These 5 cars have steadily done well in sales throughout time. Get the list here!
24/7 Wall Street shares...
5. Escort (1968 – 2000)
> Sales: 20 million
> Parent: Ford
> Price: $11,950 (2000)
> Type: inexpensive 4-cylinder 2-door/4-door
The Escort was a small, fuel-efficient car introduced in England in 1967 and then throughout much of Europe over the following two years. The vehicle was Ford’s answer to the army of small cars made by European manufacturers like Fiat, Renault, and VW. All were meant to use little gas and be cheap to operate. Most Escorts have small engines of less than 2 litres. This was enough to power 2-door, 3-door and 4-door versions of the car in a region in which gas is usually very expensive. There were six generations of Escorts. Each version offered more options and larger engines than the one before it. The Escort was replaced by the Ford Focus. A car called the Escort was sold in the U.S. from 1981 to 2003, but its great success was in Europe. That new car, sold in the U.S., unrelated in its design, is not counted here.
4. Beetle (1933 – )
> Sales: 23.5 million through 2011
> Parent: Volkswagen
> Price: $19,795 (most recent)
> Type: inexpensive rear-engine 4-cylinder
The Beetle is VW’s flagship. Launched eight decades ago, following orders by Adolf Hitler for a family-sized “people’s car,” it was designed by sports car enthusiast Ferdinand Porsche. The vehicle has changed very little since the 1940s. It is unusual among economy cars because its engine is in its rear and is air cooled. The Beetle also comes with a diesel engine, which is a rarity among passenger cars. New diesel engines get mileage similar to hybrids. The current version of the Beetle sold in the U.S. has a small 2.5 liter, 4-cylinder engine and sells for under $20,000. To appeal to more upscale buyers and those who want better engine performance, VW offers a Turbo-powered model for nearly $30,000. VW must regret it did not market the Beetle more aggressively in the U.S. when it was among the best-selling small cars in the U.S. Japanese models and a move by the Big Three to offer fuel-efficient vehicles pushed the Beetle nearly out of the U.S. market.
3. Golf (1974 – )
> Sales: 27.5 million
> Parent: Volkswagen
> Price: $17,995 (most recent)
> Type: inexpensive 4-cylinder sedan
The Golf is VW’s least expensive compact car. When it debuted in 1974, it was originally called the Rabbit in America, and was intended to be the Beetle’s successor. Like several of the other cars on this list, it is built to be within the budgets of millions of people, as well as inexpensive to operate after purchase. The popularity of the Golf, Beetle and Passat has helped drive VW to the number two car manufacturer in the world for 2011. The Golf sells for less than $18,000 in the U.S. The base model is a 2-door with a 4-cylinder, 2.5 liter engine. VW still lags every major global manufacturer in U.S. sales. It has counted on the Golf to help close that gap. But last year it only sold 324,000 cars (all models) in the U.S., which gave it a 2.2% market share — a disappointing performance for a multinational that sold over 8.1 million vehicles worldwide.
2. F-Series (1948 – )
> Sales: 35 million
> Parent: Ford (NYSE: F)
> Price: $22,990 (most recent)
> Type: Pickup
The F-Series has been America’s best-selling full-body pickup for more than 30 years. It certainly has faced significant competition over the years, especially from the Dodge Ram, Chevy Silverado and GM Sierra, which are all built by Chrysler and GM. More recently, other competitors entered the market, such as Honda with its Ridgeline, Toyota with its Tundra, and Nissan with its Titan. But none has been able to drop the F-Series from its spot at the top of the pickup market. One of the strengths of the F-Series is that it comes in so many models that have a broad appeal across a wide set of customers. The base F-150 costs less than $23,000. Larger models are used in the construction and farm business. These have engines with outputs of well over 300 horsepower and dual rear tires. The F-450 Super Duty King Ranch has a sticker price of $63,615.
1. Corolla (1966 – )
> Sales: 37.5 million
> Parent: Toyota (NYSE: TM)
> Price: $16,130 (most recent)
> Type: inexpensive 4-cylinder sedan
The Corolla has been the flagship of the world’s third-largest car company for more than four decades. The car has gone through 10 generations of model upgrades. It was the perfect car for Japan when it was introduced — small and fuel-efficient. It was a perfect car for America when oil and gas prices soared and then fluctuated after the early 1970s oil embargo. The car always has been outfitted with a small 4-cylinder engine. The current base motor output is 132 horsepower and gets as much as 35 MPG. Ironically, an even more fuel-efficient car — the Toyota Prius hybrid — outsold the Corolla in Japan in 2010.
Get the entire list at 24/7 Wall Street!
 

The blended senses of synesthesia



Synaesthetes can taste numbers, feel colours, or have other sensations triggered by sensations. Studies of their brains could provide clues for neurological disorders.

Some people with synesthesia might associate sounds with colors. (Pascal Broze, Getty Images)
 
By Lily Dayton, Special to the Los Angeles Times
February 20, 2012
If you ask Emma Anders about the number five, she'll tell you that it's red. She'll also tell you that five is a mischievous, self-centered brat — like a kid throwing a temper tantrum at a party.
"Two is yellow, three is purple, four is an intense sky blue," says the 21-year old student at UC San Diego. "An eight is very noble and kind of held together, almost like a parent figure to five. Nine is a brown-haired guy, and he's pretty calm — but he's really into seven."
For most people, a number is simply an arithmetical value that represents a quantity. But for Anders, it is also a thing that has a particular color and an entire suite of personality traits. And it's not just numbers — she also ascribes colors to flavors and smells. (Vaseline, for instance, smells burgundy, and a green apple tastes yellowish-orange.)
This is the world of synesthesia, a perceptual phenomenon in which one sense kindles sensation in another. The condition, which is harmless, is caused by increased connectivity between areas of the brain that are normally separated. As a result, when Anders sees a five, the region of her brain that perceives colors is stimulated along with the region that processes numbers.
Other synesthetes see colors when they hear music, taste words before they say them or feel textures on their fingertips when they discern the flavors of particular foods. Virtually any combination between the senses is possible in the 1% to 4% of people who have inherited the condition.
No one is trying to cure synesthesia — in fact, most synesthetes will tell you they love their synesthetic experiences and would never want to lose them. But scientists have begun studying people like Anders in hopes that what they discover about the way their brains are wired will provide clues for understanding other neurological disorders, like autism and schizophrenia.
"We're using the synesthetic brain as a model for neural hyper-connectivity," says Steffie Tomson, a neuroscientist at Baylor College of Medicine in Houston. "What we're learning is that there are very specific delicate relationships between different regions of the brain that can cause it to function normally — or to tweak."
Scientists have been aware of synesthesia for more than 100 years, but only in the last decade or so has it been considered more than a strange quirk. Recent advances in neuroimaging have allowed researchers to visualize what's going on inside a synesthete's brain when it makes its unconventional connections. The Internet has inspired the creation of online tests that have gathered data from tens of thousands of synesthetes throughout the world. And genetic sequencing has enabled scientists to come closer to pinpointing the genes that cause this condition.
David Brang, a UC San Diego neuroscientist, says nature provides a strong hint that the brains of synesthetes may have some kind of cognitive advantage. The genes for synesthesia appear to be dominant, and family trees depict the trait marching through the bloodline. This high degree of heritability suggests the genetic mutation that causes synesthesia provides some significant evolutionary benefit.
Brang's hypothesis is that the benefit is related to creativity, enhanced perception and overall smarts. So far, studies have found that so-called colored sequence synesthetes (who experience color when they see numbers or letters) have a heightened ability to discriminate between similar colors, while mirror-touch synesthetes (who experience touch sensations when watching another person touch themselves) are more sensitive to touch in general.
The search for the genes that trigger synesthesia is underway in David Eagleman's lab at Baylor College of Medicine, where Tomson works. Eagleman calls this nascent field "perceptual genomics," or the study of how specific genes influence how people experience the world.
"I see in synesthesia a really good inroad into understanding the brain in general and consciousness in particular," says Eagleman, who has identified a region on chromosome 16 that is linked to colored sequence synesthesia. "Here we have a condition where some small change, presumably a very tight genetic change, causes the internal experience to be completely different from someone else's."
The study of synesthesia has helped shift the way scientists think about the brain. In the past, they have focused on matching different areas with specific functions; now, the entire organ is viewed as a tapestry of interwoven connections.
"The whole system is a giant network," Eagleman says. "It's no longer sufficient to think about single areas in isolation."
Like synesthesia, many neurological disorders — such as schizophrenia, autism,Alzheimer's disease, depression and epilepsy — have been linked to abnormal communication between brain regions. The hope is that as neuroscientists learn about how the connections in the synesthetic brain differ from those in normal brains, they will also gain insight into how these differences develop — and how they sometimes manifest as harmful disorders.
"We're trying to understand how a different activity pattern in your brain can change the way you perceive reality," says Tomson, pointing out that studying disorders such as depression or schizophrenia in people who already have the disorder can be tricky. Not only are the network properties of these illnesses more complex than the relatively simple circuitry involved with synesthesia, but patients are often on medication, which makes it impossible to tell how their brains would function on their own.
"Synesthesia is a perfect model because we have a healthy brain that has some kind of perceptual tweak that changes the relationship between various regions of the brain," she says
Researchers in Eagleman's lab are also studying sensory processing dysfunction (SPD), which is a hallmark characteristic of autism. People with this disorder have temper tantrums and other extreme reactions when exposed to particular tastes, sounds, textures or other stimuli.
The prevailing idea is that people with SPD experience certain stimuli as louder or more intense than normal. But Eagleman's studies of synesthesia have caused him to look at individuals with SPD in a different way.
"I think that what they're experiencing is a form of synesthesia where instead of some sense connecting to their color area, it's connecting to an area involving pain or aversion or nausea," Eagleman says. "If that's true, what we're doing in synesthesia will give us an actual molecular target for helping that."

Q&A with Yaakov Stern on Brain Reserve, Exercise, Cognitive Training, Angry Birds, YMCA and more



By: Alvaro Fernandez
I just had the chance to dis­cuss lat­est neu­ro­sci­en­tific research and think­ing with Dr. Yaakov Stern, one of the lead­ing sci­en­tists study­ing how to build a neu­ro­pro­tec­tive cog­ni­tive reserve across the lifes­pan. Dr. Stern leads the Cog­ni­tive Neu­ro­science Divi­sion at the Colum­bia Uni­ver­sity Sergievsky Cen­ter. What fol­lows is a Q&A ses­sion con­ducted via email over the last week.
Alvaro Fer­nan­dez: What do you make of the recent study “Asso­ci­a­tion of Life­time Cog­ni­tive Engage­ment and Low β-Amyloid Depo­si­tion”? 
Yaakov Stern: I find these results very intrigu­ing. The con­cept of cog­ni­tive reserve posits that var­i­ous life­time expo­sures such as edu­ca­tion, occu­pa­tion and leisure activ­i­ties may be related to dif­fer­en­tial sus­cep­ti­bil­ity to Alzheimer’s pathol­ogy once it occurs. This paper con­tin­ues a new, ongo­ing theme that cer­tain life­time clo­sures may actu­ally impact on the brain changes or patho­logic find­ings them­selves. While more work needs to be done to under­stand how life­time expo­sures may impact the devel­op­ment of Alzheimer’s dis­ease pathol­ogy, it is clear that both cog­ni­tive stim­u­la­tion and exer­cise help shape the brain through­out the lifes­pan. For exam­ple, ani­mal stud­ies indi­cate that both a stim­u­lat­ing envi­ron­ment and a aer­o­bic exer­cise are asso­ci­ated with neu­ro­ge­n­e­sis, the growth and uti­liza­tion of new neu­rons in the hip­pocam­pus. Thus, life events may con­tribute to what I have called “brain reserve,” but now brain reserve is a much more fluid con­cept than I orig­i­nally imagined.
AF: How do these find­ings link to your work?
YS: These types of obser­va­tions have con­tributed to the design of two inter­ven­tion stud­ies that I am cur­rently run­ning. One of them com­pares peo­ple who engage in a aer­o­bic exer­cise ver­sus stretch­ing and ton­ing for six months. We are com­par­ing these two forms of phys­i­cal exer­cise to see which is more ben­e­fi­cial. F. Before and after this exer­cise period, the par­tic­i­pants receive exten­sive cog­ni­tive eval­u­a­tion and neu­roimag­ing. The neu­roimag­ing stud­ies will help us under­stand what brain changes are asso­ci­ated with any cog­ni­tive improve­ment that we see. One unique aspect of this study is that it is enrolling younger peo­ple that have been included in pre­vi­ous stud­ies. We are recruit­ing indi­vid­u­als who are 30 – 45 and 50 – 65.
AF: What is the cur­rent under­stand­ing on what adults may need, and ben­e­fit from? are pri­or­i­ties and likely inter­ven­tions the same when we talk about younger vs. older adults?
YS: That is exactly what I’d like to find out. The ani­mal stud­ies and some stud­ies of younger adults sug­gest that exer­cise may impact both the cog­ni­tion and the brain across all ages. The goal of my study is to see whether it has sim­i­lar effi­cacy in younger and older indi­vid­u­als, whether the same cog­ni­tive processes are enhanced, and whether the neural basis for improve­ment is the same across these age groups. In the sec­ond ongo­ing study, we are look­ing at the rel­a­tive ben­e­fits of phys­i­cal and cog­ni­tive exercise.
AF: What is the cur­rent under­stand­ing on the rel­a­tive mer­its and short­com­ings of phys­i­cal and cog­ni­tive exer­cise? do you see them as some­how mutu­ally exclu­sive or as synergistic?
YS: My view is that they are syn­er­gis­tic. It makes sense to me that any improve­ments in “brain reserve” would heighten the abil­ity to develop a more “cog­ni­tive reserve.” To explain, we know that both exer­cise and cog­ni­tive stim­u­la­tion affects the brain itself. For exam­ple, they both up reg­u­late a chem­i­cal that is respon­si­ble for increased synap­tic plas­tic­ity. The advan­tage I see to cog­ni­tive train­ing is that it can enhance spe­cific cog­ni­tive func­tions. It may be that peo­ple will be ben­e­fit more from this cog­ni­tive train­ing when they exer­cise, since exer­cise may help the brain be more recep­tive to this train­ing. To test this idea, we are run­ning another study where par­tic­i­pants engage in both videogames designed to enhance cog­ni­tive func­tion (specif­i­cally, atten­tional allo­ca­tion), and also exer­cise. This study is open to peo­ple aged 60 and over. I must say that this study is more demand­ing because it requires both for vis­its to the gym a week and three vis­its to our lab to play the video game. One unique fea­ture of both of our stud­ies is that we have part­nered with all of the YMCAs in Man­hat­tan, so that par­tic­i­pants can con­duct their exer­cise ses­sions in any loca­tion that is con­ve­nient to them.
AF: Why did you select that par­tic­u­lar videogame and not, say, Tetris or Angry Birds?
YS: We are using the Space Fortress game because I believe that it may enhance atten­tional allo­ca­tion and exec­u­tive con­trol. I feel that these are very impor­tant cog­ni­tive func­tions and enhanc­ing them may directly impact on and improve the per­for­mance of many day-to-day activ­i­ties. We are com­par­ing the Space Fortress game with more stan­dard com­puter games, since it is quite pos­si­ble that they may be ben­e­fi­cial as well.
AF: So, your stud­ies will mea­sure the impact of mov­ing from a seden­tary lifestyle to exer­cis­ing at least 4 times a week. Would you expect the result­ing ben­e­fit to be more or less pro­nounced than if some­one already exer­cis­ing at four times per week increase to eight times per week?
YS: I am not sure what the answer to this is. Most exer­cise stud­ies begin with peo­ple who are not reg­u­lar exer­cis­ers because we believe that it will increase the chance that we can see an effect. My guess is that any increase in exer­cise may also be ben­e­fi­cial, but it would be harder to detect.
AF: The YMCA part­ner­ship is fas­ci­nat­ing, a very inno­v­a­tive way to do community-based research. How does it work? Who greets/ supervises/ sup­ports peo­ple? Was it dif­fi­cult to engage them? And, where do the com­put­er­ized cog­ni­tive work­outs take place?
YS: I agree that the part­ner­ship with the YMCA is very excit­ing. Peo­ple par­tic­i­pat­ing in our stud­ies get free access to the gym at any YMCA in Man­hat­tan. Our per­son­nel ini­tially meets par­tic­i­pants at the gym and ori­ent them to what they need to do. The gyms all have res­i­dent train­ers who know about the stud­ies and can give advice as needed. Right now the com­put­er­ized cog­ni­tive work­outs are done at our med­ical cen­ter. We are cur­rently work­ing on the tech­nol­ogy to allow peo­ple to play the games from their home in a way that we can directly mon­i­tor their per­for­mance. This should make it a lit­tle eas­ier for peo­ple to participate.
AF: Who is eli­gi­ble for your stud­ies and how can they sign up?
YS: As I men­tioned above, one study is recruit­ing peo­ple ages 30 to 45 and 50 to 65. The sec­ond, more inten­sive study is recruit­ing peo­ple age 60 and older. Both of these stud­ies are look­ing for indi­vid­u­als who are not reg­u­lar exer­cis­ers, because this should enhance our abil­ity to find an effect of exer­cise on cog­ni­tion. Our coor­di­na­tor can help answer ques­tions about whether you are eli­gi­ble or not. Any­one inter­ested poten­tially par­tic­i­pat­ing in one of these two stud­ies can con­tact Caitlin Slight: cbs2139 at columbia.edu.
Posted by
Robert Karl Stonjek

Anticipation of stressful situations accelerates cellular aging




The ability to anticipate future events allows us to plan and exert control over our lives, but it may also contribute to stress-related increased risk for the diseases of aging, according to a study by UCSF researchers.
In a study of 50 women, about half of them caring for relatives with dementia, the psychologists found that those most threatened by the anticipation of stressful tasks in the laboratory and through public speaking and solving math problems, looked older at the cellular level. The researchers assessed cellular age by measuring telomeres, which are the protective caps on the ends of chromosomes. Short telomeres index older cellular age and are associated with increased risk for a host of chronic diseases of aging, including cancer, heart disease and stroke.
"We are getting closer to understanding how chronic stress translates into the present moment," said Elissa Epel, PhD, an associate professor in the UCSF Department of Psychiatry and a lead investigator on the study. "As stress researchers, we try to examine the psychological process of how people respond to a stressful event and how that impacts their neurobiology and cellular health. And we're making some 
strides in that."
The researchers also found evidence that caregivers anticipated more threat than non-caregivers when told that they would be asked to perform the same public speaking and math tasks. This tendency to anticipate more threat put them at increased risk for short telomeres. Based on that, the researchers propose that higher levels of anticipated threat in daily life may promote cellular aging in chronically stressed individuals.
"How you respond to a brief stressful experience in the laboratory may reveal a lot about how you respond to stressful experiences in your daily life," said Aoife O'Donovan, PhD, a Society in Science: Branco Weiss Fellow at UCSF and the study's lead author. "Our findings are preliminary for now, but they suggest that the major forms of stress in your life may influence how your respond to more minor forms of stress, such as losing your keys, getting stuck in traffic or leading a meeting at work. Our goal is to gain better understanding of how psychological stress promotes biological aging so that we can design targeted interventions that reduce risk for disease in stressed individuals. We now have preliminary evidence that higher anticipatory threat perception may be one such mechanism."
The study will be published in the May issue of the journal Brain, Behavior and Immunity.
Research on telomeres, and the enzyme that makes them, was pioneered by three Americans, including UCSF molecular biologist and co-author on this manuscript Elizabeth Blackburn, PhD, who co-discovered the telomerase enzyme in 1985. The scientists received the Nobel Prize in Physiology or Medicine in 2009 for this work.
Provided by University of California, San Francisco
"Anticipation of stressful situations accelerates cellular aging." February 21st, 2012. http://medicalxpress.com/news/2012-02-stressful-situations-cellular-aging.html
Posted by
Robert Karl Stonjek

Cocaine and the teen brain: Study offers insights into addiction




When first exposed to cocaine, the adolescent brain launches a strong defensive reaction designed to minimize the drug's effects, Yale and other scientists have found. Now two new studies by a Yale team identify key genes that regulate this response and show that interfering with this reaction dramatically increases a mouse's sensitivity to cocaine.
The findings may help explain why risk of drug abuse and addiction increase so dramatically when cocaine use begins during teenage years.
The results were published in the Feb. 14 and Feb. 21 issues of the Journal of Neuroscience.
Researchers including those at Yale have shown that vulnerability to cocaine is much higher in adolescence, when the brain is shifting from an explosive and plastic growth phase to more settled and refined neural connections characteristic of adults. Past studies at Yale have shown that the neurons and their synaptic connections in adolescence change shape when first exposed to cocaine through molecular pathway regulated by the gene integrin beta1, which is crucial to the development of the nervous system of vertebrates.
"This suggests that these structural changes observed are probably protective of the neurocircuitry, an effort of the neuron to protect itself when first exposed to cocaine," said Anthony Koleske, professor of molecular biophysics and biochemistry and of neurobiology and senior author of both papers.
In the latest study, Yale researchers report when they knocked out this pathway, mice needed approximately three times less cocaine to induce behavioral changes than mice with an intact pathway.
The research suggests that the relative strength of the integrin beta1 pathway among individuals may explain why some cocaine users end up addicted to the drug while others escape its worst effects, Koleske theorized.
"If you were to become totally desensitized to cocaine, there is no reason to seek the drug," he said.
Koleske and Jane R. Taylor, professor of psychiatry and psychology and an author of the Feb. 14 paper, are teaming up with other Yale researchers to look for other genes that may play a role in protecting the brain from effects of cocaine and other drugs of abuse.
Shannon Gourley, now of Emory University who worked with Koleske and Taylor, is lead author on the Feb. 14 paper detailing how the structural response to cocaine protects against cocaine sensitivity. Anastasia Oleveska and Michael S. Warren are other Yale authors on this paper. Warren and William D. Bradley of Yale are co-lead authors of the latest Neuroscience paper describing the role for integrin beta 1 in the control of adolescent synapse and dendrite refinement and stability. Yu-Chih Lin, Mark A. Simpson, Charles A. Greer are other Yale-affiliated authors.
Provided by Yale University
"Cocaine and the teen brain: Study offers insights into addiction." February 21st, 2012. http://medicalxpress.com/news/2012-02-cocaine-teen-brain-insights-addiction.html
Posted by
Robert Karl Stonjek