With their discovery of the structure of DNA Watson and Crick started the unravelling of the mystery around this molecule. But after that the questions started rising: how was the DNA able to copy itself with every cell division? And how did the DNA eventually lead to genetic properties?
The copying
When a cell divides, the two strands of DNA are seperated. The bonds between the basepairs are broken, forming a sort of zipper.
After seperation the two strands exist with single bases. Then the copying starts. On the opposite of each A in the strand a T is built in the new strand, on the opposite of a G a C is built in. The missing strand is built again from single nucleotides, so a copy is made. This is also done for the other strand. In the picture the pink strand is the old strand and the blue one the new strand. Eventually two double stranded DNA molecules exist. These are seperated from each other during cell division, so each cell gets its own molecule.
The genetic code
DNA codes for genetic properties in our body by the unique sequence of the bases. To express these properties the nucleotide sequence must be translated into proteins. Proteins consist of a sequence of specific building blocks. these building blocks are called amino acids.
There are 20 different amino acids. Each amino acids is coded by a 'word' of 3 bases. Such a word is called a codon. Because there are many different combinations of 3 bases there is a clear overview table of all the codons. All amino acids also have a 1-letter code, not shown in the table. There is 1 codon that codes a starting-signal in a protein, that is the codon for the amino acid Methionine (Met): AUG. And there are 3 codons that give a stop-signal. The nucleotide sequence between the startcodon and the stopcodon is eventually translated into a protein.
The translation
To go from nucleotide sequence to proteins the DNA must first be translated to a structure that is similar to DNA. This is RNA (RiboNucleicAcid) and it has almost the same structure as DNA. There is an important difference between DNA and RNA: RNA is single stranded, in contrary to DNA, which is double stranded. And besides that RNA has in stead of the base Thymidine (T) the base Uracil (U). The function of RNA is to transport the genetic material and thus is a sort of messenger. That is why the molecule is also called messenger RNA (mRNA). mRNA has to take the genetic information from inside the nucleus to the outside, so the translation into protein can continue. This happens on ribosomes, a compartment of the cell. The ribosomes read the nucleotide sequence between the startcodon and the stopcodon and translate this into an amino acid sequence:
DNA ATGCGTGCAATGTTTACGCGTAAAGCGTGCACGTTAGAGTGA
TACGCACGTTACAAATGCGCATTTCGCACGTGCAATCTCACT
RNA AUGCGUGCAAUGUUUACGCGUAAAGCGUGCACGUUAGAGUGA
Protein Start - R-A-M-F-T-R-K-A-C-T-L-E - Stop
This sequence forms a protein with a certain genetic property. For instance a protein that codes for eyecolor or bloodgroup.
The copying
When a cell divides, the two strands of DNA are seperated. The bonds between the basepairs are broken, forming a sort of zipper.
After seperation the two strands exist with single bases. Then the copying starts. On the opposite of each A in the strand a T is built in the new strand, on the opposite of a G a C is built in. The missing strand is built again from single nucleotides, so a copy is made. This is also done for the other strand. In the picture the pink strand is the old strand and the blue one the new strand. Eventually two double stranded DNA molecules exist. These are seperated from each other during cell division, so each cell gets its own molecule.
The genetic code
DNA codes for genetic properties in our body by the unique sequence of the bases. To express these properties the nucleotide sequence must be translated into proteins. Proteins consist of a sequence of specific building blocks. these building blocks are called amino acids.
There are 20 different amino acids. Each amino acids is coded by a 'word' of 3 bases. Such a word is called a codon. Because there are many different combinations of 3 bases there is a clear overview table of all the codons. All amino acids also have a 1-letter code, not shown in the table. There is 1 codon that codes a starting-signal in a protein, that is the codon for the amino acid Methionine (Met): AUG. And there are 3 codons that give a stop-signal. The nucleotide sequence between the startcodon and the stopcodon is eventually translated into a protein. The translation
To go from nucleotide sequence to proteins the DNA must first be translated to a structure that is similar to DNA. This is RNA (RiboNucleicAcid) and it has almost the same structure as DNA. There is an important difference between DNA and RNA: RNA is single stranded, in contrary to DNA, which is double stranded. And besides that RNA has in stead of the base Thymidine (T) the base Uracil (U). The function of RNA is to transport the genetic material and thus is a sort of messenger. That is why the molecule is also called messenger RNA (mRNA). mRNA has to take the genetic information from inside the nucleus to the outside, so the translation into protein can continue. This happens on ribosomes, a compartment of the cell. The ribosomes read the nucleotide sequence between the startcodon and the stopcodon and translate this into an amino acid sequence:
DNA ATGCGTGCAATGTTTACGCGTAAAGCGTGCACGTTAGAGTGA
TACGCACGTTACAAATGCGCATTTCGCACGTGCAATCTCACT
RNA AUGCGUGCAAUGUUUACGCGUAAAGCGUGCACGUUAGAGUGA
Protein Start - R-A-M-F-T-R-K-A-C-T-L-E - Stop
This sequence forms a protein with a certain genetic property. For instance a protein that codes for eyecolor or bloodgroup.
No comments:
Post a Comment